Plant Transcription factor database - CTBE
version: 3.0

Selaginella moellendorffii Transcription Factor Database


>36646 [Selaginella moellendorffii]  gw1.1.942.1 transcript sequence BLAST
GAGAACGATCGCGTCGAGGAGTGGGAGGAGGGCCTGCCGACGCCGGAGGAGCTGACGCCCTTGAATCAGAGCTTGATCAC
GCCGGAGCTGGCCAGCGCATTTAGCATCTCGCAGGAGGCGGCCAAATCCTCGTCGGACGTGCTGCACGCCTCGATCGCCA
CGGTCACGGCGCTGCGGCGCCAGCCATCGTCGTCGCCCGGGGGCGTGTTCGAGTCGATCCCCGCGTTTCCACAATCGTCG
GATCTGGGCGAGGAGGAGGAGGCCGACTCTGGCGGGGGTCCCGAGAACTCCGGCGAGGAGCCGGCCGCTAGAACGCTCAA
GAGGCCGAGGCTGGTTTGGACTCCACAGCTCCACAAGCGATTCGTGGACGCGGTGGCGCACCTGGGGATCAAGAACGCGG
TGCCAAAGACGATCATGCAGCTGATGAACGTGGAGGGTCTCACGCGAGAGAACGTCGCCAGCCATCTCCAGAAGTACCGT
CTCTATCTCAAGCGGATGCAGGGGCTCTCGAGCGAGGGGCCGTCGGCCTCGGATCATCTCTTTGCCTCCACGCCGGTTCC
T