Plant Transcription factor database - CTBE
version: 3.0

Populus trichocarpa Transcription Factor Database


>272182 [Populus trichocarpa]  gw1.1499.7.1 transcript sequence BLAST
ATGAGAGAGGATGATTCTAATTGGTTTTCAAGATGGGAAGAAGAGCTCCCATCACTTGAAGAACTCATGCCTTTATCACA
AACCCTAATCACTCCTGATCTTGCTCTTGCTTTTGATATTACAAACCCCACTAATACCACCAATACCAATAACCATAACT
CCTCTCTGCATCAAAACCAGCCTCTACCACCACCCCCACCACCACCGGCTGCGGTTTCTCCAACCCCAACTAATCCATTG
GCCTCACCACAGCCTAATTCAGGGGATTTTGCAACGGATTCTGGGGAATTGGGCTCAGGGGCTGGTGGTGATGAGCCTGC
AAGAACCCTTAAAAGGCCAAGGCTTGTTTGGACTCCACAGCTTCATAAGAGGTTTGTGGATGCTGTGGCACACTTGGGGA
TAAAGAATGCTGTCCCTAAGACAATAATGCAGTTAATGAATGTGGATGGGTTAACTAGAGAGAATGTTGCTAGTCATTTG
CAAAAATATAGACTTTATTTGAAAAGAATGCAGGGTTTGTCTTCTGGTGGTGGTGGTCCTGGTAATGGTGCTGTTGGTGG
TGGAGGTGGATTGACTGGTGGCTCTGATGCTGCTACTGATCATTTGTTTGCGAGTTCGCCGGTGCCAGCCCATTTTTTGC
ATCCA